中文
Gene Transferers:
Gene Transferers
- pTT5 plasmid
- Product Detail
- Company Profile
pTT5
PVT1032 2ug
pTT5 Plasmid information
Promoter: CMV
Replicon: PMB1 ori
Terminator: beta globin poly (A) signal
Plasmid classification: mammalian cell carrier; protein over expression plasmid
Plasmid size: 4401bp
Prokaryotic resistance: ampicillin Amp
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expression host: mammalian cells
Culture conditions: 37, aerobic, LB
Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG
Primers for 3'sequencing: Based on sequence design
pTT5 Map
-
Life Science Market is a supplier of life science reagents. Our products cover a growing variety of ELISA kits, proteins, peptides, antibody products. We are dedicated to supporting your research and development.
| Request Information |
| Other Products |
|
|
| Related Products |
| Recently viewed products |